Follow us on :


Take a look at the Recent articles

The Il2 'S Problem, Il4 Evidence in Asterias Rubens Sea Star.(Echinoderm)

Michel Leclerc

556 Rue Isabelle Romée 45640 Sandillon, France

E-mail : mleclerc45@gmail.com

Nicolas Kresdorn

GenXPro , Frankfurt, Germany

DOI: 10.15761/CPB.1000103

Article
Article Info
Author Info
Figures & Data

Abstract

IL2-like activity was described in sea star, in the past butfirst sea star genome studiesdid not confirm the presence of IL2 in A.rubens. A new genomic survey of Interleukins: IL2 and IL4 was done, in this invertebrate.

Introduction

Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the invertebrate innate and adaptative immunity.

Here, we present a survey of the Asteriasrubens sea star genome for genes associated with immunity.In a preliminary work (1) IL1 and IL1R were detected but not IL2, IL4.Our purpose was to research potential interleukins: IL2, IL4 immune receptors, regulators and effectors, particularly,including unprecedented expansions of innate pathogen recognition genes.

Materials and Methods

Immunized and non-immunized A.rubens sea stars to HRP(Horse-radish peroxydase) were used.Their axial organs were removed. RNA was extracted using Trizol(Invitrogen) according to manufacturer instructions. The

Following steps were already described[1], the cDNA was sequenced on the illumina GSII platform sequencing 1. 100 bp from one side of the approximately 200bp fragments.Sequences were assembled using Velvet [2].

Results

Immunizedsea star genome shows a first result in the Table 1.

Table 1: sea star similarities to human tcf 8 (1), to IL4 induced 1 (2).

tr|B2RBI8|B2RBI8_HUMAN cDNA, FLJ95535, highly similar to Homo sapiens transcription factor 8 (represses interleukin 2 expression) (TCF8), mRNA OS=Homo sapiens PE=2 SV=1
 

tr|A2RRH1|A2RRH1_HUMAN Interleukin 4 induced 1 OS=Homo sapiens GN=IL4I1 PE=2 SV=1

The table 1 is correlated to the Figure 1 which is following:

Figure 1:tcf 8 sequence( 5'-3') .

5'GGAGGATTCACTGGGTGAACTCTCCCCAAACCGCGACCGCAGGAGACGAGATCGTCCTCT
ACGTACCTCTGCTGGACTCTACTCATGCACCCAGTGCCCCAAGACATTCCAGAAGCACAG
CTCCCTGCTCAGACACGTGTACGAGCACTCAGGTGAGCCAAAAAGTAAGCGTCCACACGA
GTGTAAGGAGTGCGGCAAGGCCTTTAAGCACAAGCACCACCTCATGGAGCACGCGCGTCT
TCATAGTGGTGAGAAGCCATACCAGTGTGACAAGTGCCTTAAGAAGTTCTCTCACTCCGG
CTCCTACAGCCAGCACATGAACCATCGCTACAGCTACTGCCGTAAAGAGGACAATCTCAA
CAGGGGGATGAGCAAAGGTGGTATGGATGAAGATGAGGAGATGATGGAAGATGGAGAACT
TGAAAGATGTAAGCAGAGTGGG3'

One contig (Contig12015|m.10216) could be annotated via BLASTX to Homo sapiens "cDNA, FLJ95535, highly similar to Homo sapiens transcription factor 8 (represses interleukin 2 expression) (TCF8), mRNA" from the TREMBL database, with an e-value of 3e-40. On an aligned region of 96 amino acids, 79 positive and 71 identical amino acids were found.

Another contig allows us to report the IL4obtained sequence in immunized sea stars to HRP

(Figure 2)

Figure 2: Sequence of IL4 induced 1.

5'TCTGGTTGTTGAGGCTCGAGATCGTCTCGGAGGTCGAACCCACACTCTGGTGGACCCCTCCATTGGTTATGTGGATTTGGGCGGAGCTTACGTCGGCCCCACCCAGAATCGTCTTCTCCGTATGGCCAAGGAACTGGGCGTGGAAAACTACAAGATCAACGAAGCTGAGAGGCTTGTTTGGGTTGATAATCAACGTGGTTACCCTTTCAAGGGATCATGGCCCAAGTTCTGGAACCCTCTCGTCAATCTGGATTTGAATAACGCTATCCGAGAGATCGACAGACTTGGAGATATGATTTCAGTGGATGCACCTTGGGACGCACCAAATGCCGAAGAGCTGGATAACATGACGATGAAAGAATGGATCGACAAGACATGTTGGACAGAAAGCATCCGCCGTCTTTTTATTACAACTTGTGAGGTTGGCGTTTGCATGGAACCCCAAGAGCTATCGGTCCTCTTCTTCGCGTGGTATCTGAAACAGACAGGTGGATACGTTCGATTTATATCGAGTGATAATGGCGGCCAGGAGCGGAAGTTTGTTGGTGGATCTCAGCAGATAAGCATTAAGATGGGAGAGAAGATCGGCAAAGAGAACATCAAGATGGAGAGTCCAGTAGCTCAGATTAATCAGAGTGAGGAGTCTGTTTCTGTGCACACCATCAACGGAGATGTCTATCAGGCTAAGTACGTGATCAGCGCAATGGCCCCACCTTTGAC
CCAGAAGATTCACTATGACCCGCCCCTGCCTCCTAGGAGAAACCAGCTGATATCCAGAGCCCCTGTAGGCAGTGTCATCAAGTGCATGGTGTACTACGACAAGACATGGTGGAAAGATAGAGATTTTTGTGGCTCCACCTTCAACGTTGACCCAGCAAGTCCGATGGTGTATTCACTTGATGACACAAAACCTGATGGCAGTCACCCAGCCCTTATCTGTTTTGTGGCTGCTAACAAGGCCAGAGAGTTCTGCGGGATCAGCAAAGAGGAAAGACGAGACAGGCTGTGCAGATGTTACAGTGCTGCCTTCGGTGGAGCAGAGGAAGCCTTACACCCTATCAACTACAAGGAGAAGAACTGGATGAATGAGCAGTACTCCGGTGGCTGCTACACCTCTACCTATGGCCCTGGTGTTCTGACTCAACTTGGAAAAGAGCTCCGTAAACCATTTGGCAGATTGTATTTTGCTGGGACTGAAACTGCGACACACTGGGCTGGCTACATGGAAGGAGCTATACAGGCTGGAGAGAGAGCTGCTAGGGAGATTCAGCACAGAATGGGAAAGATTGACGAGAATGAAATCTGGCAGGATGAACCAGAATCAAAGGAGGTGCCAGCCCTTCCGATACCGACCACCTTCTACGAACGCAACGCTCCATC
TGTACCTGGCTTGTTTAAATTCATTGGTCGTACTGTTGTCTTGTCTGCTGTTATCGGAGTCTTCGCGATCTGCCGCCTGAAGAAAAAATAAACCACATCGATCGACGAGCCGAGACAAACCAACTCCTGAAGATATTCCTGAGTGAGCCAAACTCCATTCATAGAAAAATTATTCAATTTAATGCGATTCATTGAGAGATTTATTTCAAGATATTGTCTTTGAGAAAGAAAAAAATACTGTCAATATAAACAAATGTGGAGGCGCGTTCAAACAAGCAGAGTTTGTCAAGAAACGTCCTACAAAAAAACCGAAACAAAACCACAAGTTTACAAAGGTAAAAAAATAAACAAAATAATTGATTATATTGCATGACTTTAATCATGTGATGTGGTTGAATGCCGGCAGAGTTACTATTTTATTTTATTAATTTGGTGTTTAGGGTTCTATTAGTTTTTGGTTTAGTAGCATTTGTTTCTTTAGGTAAGTGGCAACAATTTCAAATTAATACTGCGATCCCAGTTTCCATAAACAAAGTGTTTCAATGAACTAACCCCTAGGGCTCAGTTTCATGGAACTGCTTAAGCATAAAAAGTTGCTAAGCACAGACAAATTATGCTAACCCGATTAACGTTACCAGCTAAAATACAGCTATACATGTACACAATGTAAATGGTATCCTGCTTAAATGTGCTTAGCGGGAAAATTTCTGCTTGCCACTTGTGTGATAACTAGTGATATATCACAAAACTGTTATCTTGTTTATTGAATAGCTCGCCTTGTACATGTAGGACCTTTTCTTTTTTTCTTGCTGGACGTATGAAAGTCAATTAATCCTTAAAAAAGGAAACTGAAGTAATGGAAAGAAAGTCAAGATTTGTGTGAAGTTGCAGTGGAAGCTGTCAAAGTTTCCTCTGAAGAATGATTCTGTTTGAAATAAGATGGTCACTTTGTGGATGACTGTATGAGGCGCCATAAATATGCCTTTTTTAAATAATAATAATAATTATTTTTGTAGGTTTTATTATTATCACATTAGTTTGAATGGTGACTTTGAAGTACACACTGAA3'

X

One contig (Contig10756|m.9341) could be annotated via BLASTX to Homo sapiens "Interleukin 4 induced 1" from the TREMBL database, with an e-value of 2.28e-16. On an aligned region of 453 amino acids, 187 positive and 105 identical amino acids were found.

Discussion and Conclusion

We have learnt that sea star T lymphocytes can release soluble lymphokin mediators, after stimulation with P.W.M( Pokeweed mitogen) sepharose 6 MB beads with mitogenic properties [3]IL2-like was discovered in Legac et al [4], using flow cytometric discrimination, but first genomic studies [1]didn't corroborate this cytometric result.

So, recently, we took back genomic works:

We mainly found TCF8, which represses interleukin 2 expression in man, but what did it do in sea star? Is it an indirect evidence of IL2 in Asteriasrubens ?..It remains enigmatic. We also found IL4 in immunized sea stars only. IL4 induced 1: an interleukin induced by B lymphocytes and why notby sea starB lymphocytes?[1].

The possibleabsence of true IL2may reflect the difficulties of identifying these rapidly evolving genes, which have slow protein domain complexity and complex intron-exon structure..

Nevertheless, members of most cytokine and chemokine families and their receptorswere detected in the sea star genome.

In conclusion, our data are consistent with the hypothesis that a true cytokine network exists in Asteriasrubens genome.

References

  1. Leclerc M (2012)Innate and Adaptative Immunity in the Sea-Star AsteriasRubensAmer. J.Immunol8: 78-83.
  2. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18: 821-829.[Crossref]
  3. Leclerc M, Brillouet C, Luquet G, Agogue P, Binaghi RA (1981) Properties of cell subpopulations of starfish axial organ: in vitro effect of pokeweed mitogen and evidence of lymphokine-like substances. Scand J Immunol 14: 281-284.[Crossref]
  4. Legac E, Vaugier GL, Bousquet F, Bajelan M, Leclerc M (1996) Primitive cytokines and cytokine receptors in invertebrates: the sea star Asteriasrubens as a model of study. Scand J Immunol 44: 375-380.[Crossref]

Editorial Information

Editor-in-Chief

Abdul R. Asif
University Medical Center Göttingen

Article Type

Short Communication

Publication history

Received date: February 04, 2016
Accepted date: March 01, 2016
Published date: March 08,2016

Copyright

©2016Michel Leclerc.This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Michel Leclerc (2016) The Il2 ‘S problem, Il4 evidence in Asteriasrubens sea star(Echinoderm)1: doi: 10.15761/CPB.1000103

Corresponding author

Michel Leclerc

556 Rue Isabelle Romée 45640 Sandillon,France, Tel: 02 38 41 02 09.

E-mail : mleclerc45@gmail.com

Table 1: sea star similarities to human tcf 8 (1), to IL4 induced 1 (2).

tr|B2RBI8|B2RBI8_HUMAN cDNA, FLJ95535, highly similar to Homo sapiens transcription factor 8 (represses interleukin 2 expression) (TCF8), mRNA OS=Homo sapiens PE=2 SV=1
 

tr|A2RRH1|A2RRH1_HUMAN Interleukin 4 induced 1 OS=Homo sapiens GN=IL4I1 PE=2 SV=1

Figure 1:tcf 8 sequence( 5'-3') .

5'GGAGGATTCACTGGGTGAACTCTCCCCAAACCGCGACCGCAGGAGACGAGATCGTCCTCT
ACGTACCTCTGCTGGACTCTACTCATGCACCCAGTGCCCCAAGACATTCCAGAAGCACAG
CTCCCTGCTCAGACACGTGTACGAGCACTCAGGTGAGCCAAAAAGTAAGCGTCCACACGA
GTGTAAGGAGTGCGGCAAGGCCTTTAAGCACAAGCACCACCTCATGGAGCACGCGCGTCT
TCATAGTGGTGAGAAGCCATACCAGTGTGACAAGTGCCTTAAGAAGTTCTCTCACTCCGG
CTCCTACAGCCAGCACATGAACCATCGCTACAGCTACTGCCGTAAAGAGGACAATCTCAA
CAGGGGGATGAGCAAAGGTGGTATGGATGAAGATGAGGAGATGATGGAAGATGGAGAACT
TGAAAGATGTAAGCAGAGTGGG3'

Figure 2: Sequence of IL4 induced 1.

5'TCTGGTTGTTGAGGCTCGAGATCGTCTCGGAGGTCGAACCCACACTCTGGTGGACCCCTCCATTGGTTATGTGGATTTGGGCGGAGCTTACGTCGGCCCCACCCAGAATCGTCTTCTCCGTATGGCCAAGGAACTGGGCGTGGAAAACTACAAGATCAACGAAGCTGAGAGGCTTGTTTGGGTTGATAATCAACGTGGTTACCCTTTCAAGGGATCATGGCCCAAGTTCTGGAACCCTCTCGTCAATCTGGATTTGAATAACGCTATCCGAGAGATCGACAGACTTGGAGATATGATTTCAGTGGATGCACCTTGGGACGCACCAAATGCCGAAGAGCTGGATAACATGACGATGAAAGAATGGATCGACAAGACATGTTGGACAGAAAGCATCCGCCGTCTTTTTATTACAACTTGTGAGGTTGGCGTTTGCATGGAACCCCAAGAGCTATCGGTCCTCTTCTTCGCGTGGTATCTGAAACAGACAGGTGGATACGTTCGATTTATATCGAGTGATAATGGCGGCCAGGAGCGGAAGTTTGTTGGTGGATCTCAGCAGATAAGCATTAAGATGGGAGAGAAGATCGGCAAAGAGAACATCAAGATGGAGAGTCCAGTAGCTCAGATTAATCAGAGTGAGGAGTCTGTTTCTGTGCACACCATCAACGGAGATGTCTATCAGGCTAAGTACGTGATCAGCGCAATGGCCCCACCTTTGAC
CCAGAAGATTCACTATGACCCGCCCCTGCCTCCTAGGAGAAACCAGCTGATATCCAGAGCCCCTGTAGGCAGTGTCATCAAGTGCATGGTGTACTACGACAAGACATGGTGGAAAGATAGAGATTTTTGTGGCTCCACCTTCAACGTTGACCCAGCAAGTCCGATGGTGTATTCACTTGATGACACAAAACCTGATGGCAGTCACCCAGCCCTTATCTGTTTTGTGGCTGCTAACAAGGCCAGAGAGTTCTGCGGGATCAGCAAAGAGGAAAGACGAGACAGGCTGTGCAGATGTTACAGTGCTGCCTTCGGTGGAGCAGAGGAAGCCTTACACCCTATCAACTACAAGGAGAAGAACTGGATGAATGAGCAGTACTCCGGTGGCTGCTACACCTCTACCTATGGCCCTGGTGTTCTGACTCAACTTGGAAAAGAGCTCCGTAAACCATTTGGCAGATTGTATTTTGCTGGGACTGAAACTGCGACACACTGGGCTGGCTACATGGAAGGAGCTATACAGGCTGGAGAGAGAGCTGCTAGGGAGATTCAGCACAGAATGGGAAAGATTGACGAGAATGAAATCTGGCAGGATGAACCAGAATCAAAGGAGGTGCCAGCCCTTCCGATACCGACCACCTTCTACGAACGCAACGCTCCATC
TGTACCTGGCTTGTTTAAATTCATTGGTCGTACTGTTGTCTTGTCTGCTGTTATCGGAGTCTTCGCGATCTGCCGCCTGAAGAAAAAATAAACCACATCGATCGACGAGCCGAGACAAACCAACTCCTGAAGATATTCCTGAGTGAGCCAAACTCCATTCATAGAAAAATTATTCAATTTAATGCGATTCATTGAGAGATTTATTTCAAGATATTGTCTTTGAGAAAGAAAAAAATACTGTCAATATAAACAAATGTGGAGGCGCGTTCAAACAAGCAGAGTTTGTCAAGAAACGTCCTACAAAAAAACCGAAACAAAACCACAAGTTTACAAAGGTAAAAAAATAAACAAAATAATTGATTATATTGCATGACTTTAATCATGTGATGTGGTTGAATGCCGGCAGAGTTACTATTTTATTTTATTAATTTGGTGTTTAGGGTTCTATTAGTTTTTGGTTTAGTAGCATTTGTTTCTTTAGGTAAGTGGCAACAATTTCAAATTAATACTGCGATCCCAGTTTCCATAAACAAAGTGTTTCAATGAACTAACCCCTAGGGCTCAGTTTCATGGAACTGCTTAAGCATAAAAAGTTGCTAAGCACAGACAAATTATGCTAACCCGATTAACGTTACCAGCTAAAATACAGCTATACATGTACACAATGTAAATGGTATCCTGCTTAAATGTGCTTAGCGGGAAAATTTCTGCTTGCCACTTGTGTGATAACTAGTGATATATCACAAAACTGTTATCTTGTTTATTGAATAGCTCGCCTTGTACATGTAGGACCTTTTCTTTTTTTCTTGCTGGACGTATGAAAGTCAATTAATCCTTAAAAAAGGAAACTGAAGTAATGGAAAGAAAGTCAAGATTTGTGTGAAGTTGCAGTGGAAGCTGTCAAAGTTTCCTCTGAAGAATGATTCTGTTTGAAATAAGATGGTCACTTTGTGGATGACTGTATGAGGCGCCATAAATATGCCTTTTTTAAATAATAATAATAATTATTTTTGTAGGTTTTATTATTATCACATTAGTTTGAATGGTGACTTTGAAGTACACACTGAA3'

X