Follow us on :


Take a look at the Recent articles

Asterias Rubens : The Toll-LikeReceptors (Tlr)

Michel Leclerc

556 Rue Isabelle Romée 45640 Sandillon, France

E-mail : mleclerc45@gmail.com

Nicolas Kresdorn

GenXPro , Frankfurt, Germany

DOI: 10.15761/CPB.1000105

Article
Article Info
Author Info
Figures & Data

Abstract 

Sea star TLR receptorsweredescribed in the presentpaper. Most of them correspond to mouse TLR in theirgenome. Twootheroneswerefound in Drosophilamelanogaster and itsgenome.

Introduction 

At the end of the 20 th century, Tollalsonamed Drome wasshown to be an essential receptor for host defenseagainstfungal infection in Drosophilamelanogasterwhichonly has innateimmunity.Later a mammalianhomolog of the Tollreceptor (nownamed TLR4) wasdiscovered to induce expression of genesinvolved in inflammatoryresponse.Furthermore, activation of innateimmunityis a criticalstep to the development of adaptative immunitywhichhas been described in mammals and also in sea star immune system [1].The aim of the presentwork, is to report genomicstudiesconcerning TLR in immunized and non-immunizedsea stars to HRP.

Materials and Methods

Sea stars wereobtainedfrom the Biology Institute (GothenbughUniversity) Immunizations, genomic studies were already described[2].. Afterligation of adapters for Illumina's GSII sequencing system, the cDNAwassequenced on theIllumina GSII platformsequencing. 1.100 bpfrom one side of the approximately 200 bp fragments sequences were assembled using Velvet (Zerbino and Birney : [3])

Results 

First resultsconcern significative TLR genesfound in control sea stars (a) and immunizedsea stars (HRP) (b and c) as compared to Drosophilamelanogastergenome :

a) control :

Contig13262582tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=DrosophilamelanogasterN=Tollo PE=4 SV=1
b) immunizedsea stars to HRP

Contig3456|m.61431127tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=Drosophilamelanogaster GN=Tollo PE=4 SV=1
Contig17904|m.13098711tr|M9NDW9|M9NDW9_DROME Toll-9, isoform B OS=Drosophilamelanogaster GN=Toll-9 PE=4 SV=1

c) DROME Toll-9 isoform B in immunizedsea star (sequence) :

One contig (Contig17904|m.13098) couldbeannotvated via BLASTX to Drosophilamelanogaster "Toll-9, isoform B" from the Trembldatabase (M9NDW9_DROME), with an(e-value of3.98e-25. On an alignedregion of 204 aminoacids, 109 positive and 68 identicalaminoacidswerefound.  

5'GGATTTCAACCCCGAAGTTTTGAACTGTGATGGAAAGATTCCGCTGCAGTATTGGATCATAATTGGTGTTGGAAACTTTGTGATCCTCGTTTTAATCATTGCTTTGATATATAATCGCTGGAAGATTTACTATGTCTACTTGTTGGTGAAGGCGCGCCATCATCGGGCAAGAAAAGACGAGTATGACAGATTGAATGATTACAGGTTCGATGCCTTCATATCTCACAGCAGCGCTGACGAGGATTGGGTCAAAGATAAACTGTTACCTGAGCTAGAGAATGGAGAGAATCCATTCAAAGTCTGCCATCACGAGCGTGATTTTGAACCTGGGCAAGAGATCATTGACAACATCATTGATTCCGTCGACCACAGCAGACGCACCATCTGTGTCATATCGAAGAGCTACCTGGAGAGCAACTGGTGCACCTACGAGAGACGGGTCACCATGAGTAAATTATTCATCAACTACAAAGATGTCCTGGTTCTGATCATCTTGGAAGATATTCCAGATAAGAAGATGTCCAAGTATGATCTCATCCACCGGGCAGTCAAGAAGAACACGTACCTGAAGTGGCCGGGAGAGGATGGAAGAGCTGATGA
GAAGGCTGTTTTCTGGCAACGCCTGAAGACAGTCTTGGGTGAAGATCGTACACCGGAAAATAATGAGGAGCTTGCTTAAAGGCACTTGCTTAAAGGCACTGGACACTGTTG3'  

d)sea star TLR receptorgeneswhencompared to mouse TLR ones :

Immunized and non-immunizedsea starsand Mouse share in common :TLR1 toll-likereceptor 1, TLR4 toll-like receptor4, TLR3 toll-likereceptor 3,TLR5 toll-like receptor5, TLR7 toll-likereceptor 7, TLR9 toll-likereceptor 9, TLR12 toll-likereceptor 12,TLR13 toll-likereceptor 13

Discussion and Conclusion 

It seemsnowobviousthat the recognition of microbial components by TLRsinitiates signal transduction pathwayswhichtriggers expression of genes. Thesegeneproducts, in Asteriasrubens, control innate immune responses and furtherinstuctdevelopment of antigen-specific adaptative immunitywhichinduces the production of the « invertebrate primitive antibody » [1].On the other hand, the presence of TLR9 (Toll-9 isoform B in Drosophila) confirms the rôleof this TLR whichmediates induction of NF Kappa-B in human[4] and maybe in sea star. Werecall the discovery, recently, of NF Kappa-B genes in sea star [5].

References

  1. Leclerc M, Otten P (2014) Immune Properties Corroborated by A. Rubens Sea Star Igkappa Gene. SAJ Biotechnology 1:104.
  2. Leclerc M, Kresdorn N, Rotter B (2013) Evidence of complement genes in the sea-star Asteriasrubens. Comparisons with the sea urchin. ImmunolLett 151: 68-70. [Crossref]
  3. Zerbino DR, Ewan Birney (2007) Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Gen Res 18: 821-829.
  4. Sandholm J, Kauppila JH, Pressey C, Tuomela J, Jukkola-Vuorinen A, et al. (2012) Estrogen receptor-α and sex steroid hormones regulate Toll-like receptor-9 expression and invasive function in human breast cancer cells. Breast Cancer Res Treat 132: 411-419.[Crossref]
  5. Leclerc M, Kresdorn N, Horres R (2016) Asteriasrubens: Evidence of NF-kappa B genes. Meta Gene 8: 30-32. [Crossref]

Editorial Information

Editor-in-Chief

Abdul R. Asif
University Medical Center Göttingen

Article Type

Research Article

Publication history

Received date: March 04, 2016
Accepted date: March 28, 2016
Published date: March 31,2016

Copyright

©2016Michel Leclerc.This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation

Michel Leclerc (2016) AsteriasRubens : The Toll-Like Receptors (TLR)1: doi: 10.15761/CPB.1000105

Corresponding author

Michel Leclerc

556 Rue Isabelle Romée 45640 Sandillon,France, Tel: 02 38 41 02 09.

E-mail : mleclerc45@gmail.com

No Data.