Abstract
Sea star TLR receptorsweredescribed in the presentpaper. Most of them correspond to mouse TLR in theirgenome. Twootheroneswerefound in Drosophilamelanogaster and itsgenome.
Introduction
At the end of the 20 th century, Tollalsonamed Drome wasshown to be an essential receptor for host defenseagainstfungal infection in Drosophilamelanogasterwhichonly has innateimmunity.Later a mammalianhomolog of the Tollreceptor (nownamed TLR4) wasdiscovered to induce expression of genesinvolved in inflammatoryresponse.Furthermore, activation of innateimmunityis a criticalstep to the development of adaptative immunitywhichhas been described in mammals and also in sea star immune system [1].The aim of the presentwork, is to report genomicstudiesconcerning TLR in immunized and non-immunizedsea stars to HRP.
Materials and Methods
Sea stars wereobtainedfrom the Biology Institute (GothenbughUniversity) Immunizations, genomic studies were already described[2].. Afterligation of adapters for Illumina's GSII sequencing system, the cDNAwassequenced on theIllumina GSII platformsequencing. 1.100 bpfrom one side of the approximately 200 bp fragments sequences were assembled using Velvet (Zerbino and Birney : [3])
Results
First resultsconcern significative TLR genesfound in control sea stars (a) and immunizedsea stars (HRP) (b and c) as compared to Drosophilamelanogastergenome :
a) control :
Contig13262582tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=DrosophilamelanogasterN=Tollo PE=4 SV=1
b) immunizedsea stars to HRP
Contig3456|m.61431127tr|Q2XXW0|Q2XXW0_DROME CG6890 (Fragment) OS=Drosophilamelanogaster GN=Tollo PE=4 SV=1
Contig17904|m.13098711tr|M9NDW9|M9NDW9_DROME Toll-9, isoform B OS=Drosophilamelanogaster GN=Toll-9 PE=4 SV=1
c) DROME Toll-9 isoform B in immunizedsea star (sequence) :
One contig (Contig17904|m.13098) couldbeannotvated via BLASTX to Drosophilamelanogaster "Toll-9, isoform B" from the Trembldatabase (M9NDW9_DROME), with an(e-value of3.98e-25. On an alignedregion of 204 aminoacids, 109 positive and 68 identicalaminoacidswerefound.
5'GGATTTCAACCCCGAAGTTTTGAACTGTGATGGAAAGATTCCGCTGCAGTATTGGATCATAATTGGTGTTGGAAACTTTGTGATCCTCGTTTTAATCATTGCTTTGATATATAATCGCTGGAAGATTTACTATGTCTACTTGTTGGTGAAGGCGCGCCATCATCGGGCAAGAAAAGACGAGTATGACAGATTGAATGATTACAGGTTCGATGCCTTCATATCTCACAGCAGCGCTGACGAGGATTGGGTCAAAGATAAACTGTTACCTGAGCTAGAGAATGGAGAGAATCCATTCAAAGTCTGCCATCACGAGCGTGATTTTGAACCTGGGCAAGAGATCATTGACAACATCATTGATTCCGTCGACCACAGCAGACGCACCATCTGTGTCATATCGAAGAGCTACCTGGAGAGCAACTGGTGCACCTACGAGAGACGGGTCACCATGAGTAAATTATTCATCAACTACAAAGATGTCCTGGTTCTGATCATCTTGGAAGATATTCCAGATAAGAAGATGTCCAAGTATGATCTCATCCACCGGGCAGTCAAGAAGAACACGTACCTGAAGTGGCCGGGAGAGGATGGAAGAGCTGATGA
GAAGGCTGTTTTCTGGCAACGCCTGAAGACAGTCTTGGGTGAAGATCGTACACCGGAAAATAATGAGGAGCTTGCTTAAAGGCACTTGCTTAAAGGCACTGGACACTGTTG3'
d)sea star TLR receptorgeneswhencompared to mouse TLR ones :
Immunized and non-immunizedsea starsand Mouse share in common :TLR1 toll-likereceptor 1, TLR4 toll-like receptor4, TLR3 toll-likereceptor 3,TLR5 toll-like receptor5, TLR7 toll-likereceptor 7, TLR9 toll-likereceptor 9, TLR12 toll-likereceptor 12,TLR13 toll-likereceptor 13
Discussion and Conclusion
It seemsnowobviousthat the recognition of microbial components by TLRsinitiates signal transduction pathwayswhichtriggers expression of genes. Thesegeneproducts, in Asteriasrubens, control innate immune responses and furtherinstuctdevelopment of antigen-specific adaptative immunitywhichinduces the production of the « invertebrate primitive antibody » [1].On the other hand, the presence of TLR9 (Toll-9 isoform B in Drosophila) confirms the rôleof this TLR whichmediates induction of NF Kappa-B in human[4] and maybe in sea star. Werecall the discovery, recently, of NF Kappa-B genes in sea star [5].
References
- Leclerc M, Otten P (2014) Immune Properties Corroborated by A. Rubens Sea Star Igkappa Gene. SAJ Biotechnology 1:104.
- Leclerc M, Kresdorn N, Rotter B (2013) Evidence of complement genes in the sea-star Asteriasrubens. Comparisons with the sea urchin. ImmunolLett 151: 68-70. [Crossref]
2021 Copyright OAT. All rights reserv
- Zerbino DR, Ewan Birney (2007) Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Gen Res 18: 821-829.
- Sandholm J, Kauppila JH, Pressey C, Tuomela J, Jukkola-Vuorinen A, et al. (2012) Estrogen receptor-α and sex steroid hormones regulate Toll-like receptor-9 expression and invasive function in human breast cancer cells. Breast Cancer Res Treat 132: 411-419.[Crossref]
- Leclerc M, Kresdorn N, Horres R (2016) Asteriasrubens: Evidence of NF-kappa B genes. Meta Gene 8: 30-32. [Crossref]